Molecular Identification and Prevalence of Ecoli isolates from urine samples

Sheryar, Shoaib ,Samina, Amna,Kanwal,Zahida,Anosha

Upcoming in PJMS with ID8380-1D

Abstract:

Uropathogenic Escherichia coli is the most frequent causative agent of Urinary Tract Infections (UTIs). There is an alarming increase in antimicrobial resistance in this pathogen which causes both community and nosocomial infections. Urine samples were collected from UTI patients of all ages from both genders. Initial characterization of samples was performed by using MacConkey agar and Triple Sugar Iron Test and Catalase test. Molecular characterization of UPEC was done by Polymerase Chain Reaction (PCR) by amplifying uidA gene. Drug resistant UPEC strains were further investigated by using some specific primers for virulence genes and genes encoding drug resistance by PCR. Exploring the latest patterns of antibiotic resistance in uropathogenic E. coli is hoped to be greatly helpful in effective management and suitable treatment options for infections due to MDR and XDR UPEC strains prevalent in this region.

2. Introduction:

Extraintestinal infection especially urinary tract infections (UTIs) increase the morbidity and mortality rate worldwide (Flores-Mireles, Walker, Caparon, & Hultgren, 2015). Escherichia coli are enteric gram negative organisms, responsible for broad variety of diseases in humans and domestic animals as well as intestinal and extraintestinal diseases. Extraintestinal infections which are caused by strains of E.coli named as Extraintestinal pathogenic Escherichia coli (ExPEC), are genetically different from those strains of E.coli that are responsible for intestinal infection (Russo et al., 2009). ExPEC causes infections in hospital settings, ambulatory and long term care and are soft tissue infections, urinary tract infections, surgical site infections, meningitis, osteomyelitis and intravascular device infections, any of which can go along with bacteremia. Escherichia coli is the most common cause of severe sepsis which is ranked 10^th for causing death in United States (Minino & Smith, 2001). In our era the pathogens like strains of ExPEC causing infections are the most important native problems. Due to Escherichia coli which costs almost 6 billion of health-care dollars and millions of workdays, more than 150 million of people are infected (Flores-Mireles et al., 2015) and 40,000 lives lost each year due to extraintestinal infections caused by this organism . Genetically and clinically E.coli is widely classified into 1. commensal strains, 2. extraintestinal pathogenic E.coli, 3. intestinal pathogenic (diarrheagenic or enteric) strains E.coli is a gram-negative microbe named by Theodor Escherich, a German physician who discovered a variety of bacilli from infant fecal samples by Hans Christian Gram’s staining Technique (Jansen & Kielstein, 2011). E.coli are a facultative anaerobes with both respiratory and fermentation metabolism mode. They are rode shaped 1.1 μm wide bacilli and 2.0–6.0 μm long with rounded ends, either motile by peritrichous flagellae or non-motile, existing in both single and pair form (Kaper, Nataro, & Mobley, 2004).

In healthy humans, Extraintestinal pathogenic E.coli colonize temporarily skin and oropharynx whereas in case of long term care and hospital settings subsequent infections are caused because of colonization of wide variety of gram negative bacteria especially ExPEC that come out as dominant flora of skin and mucosal surfaces along with severe illness, antimicrobial use and extended lengths of staying at hospitals. ExPEC is not a potential biohazard agent, it is a worldwide pathogen that easily infect people of all ages, all varieties of hosts, anatomical sites and body organs. Strains of bacteria present in faecal microbiota have specific groups of genes that encode virulence factors causing extraintestinal infections (Guyer, Henderson, Nataro, & Mobley, 2000).

Extra-intestinal pathogenic Escherichia coli (ExPEC), is the key cause of urinary tract infections. UTIs are common clinical problems in childhood, may lead to chronic kidney diseases in children. Globally Urinary tract infections are considered major health problem and more common in women as compared to men. Nearly 50-60% of women suffer from UTIs at least once in their lives (Ahmed et al., 2019). The study aimed at investigating various isolates from urine specimens from different countries in order to determine their prevalence and relationship to urinary tract infection.

3 Methodology:

3.1 Sample collection:

A total of 119 urine samples of suspected UTI patients were collected from our associated clinical laboratories and tertiary referral hospitals.

3.2 Processing of bacterial isolates:

Samples were collected according to standard guidelines under sterilized conditions in a wide mouth container with a fine sterilized screw cap in order to avoid contamination. The container was labelled with the time and date of collection, the sample number, and other information about the patient’s history such as age and gender. The suspected UTI patients with all ages and both genders having symptoms like lower abdominal pain, itching, fever, genital ulcer, pyuria, genital and suprapubic pain were investigated and patients who were on antibiotic treatment and with any other complain were not included in this study. The samples were inoculated on nutrient agar plates placed for 24 hours at 37°C and kept at 4°C.

3.3 Growth on MacConkey agar:

After overnight incubation at 37°C each sample from nutrient agar plate was shifted to MacConkey agar.  Lactose fermenters become pink, but lactose non fermenters stay colorless. This media provides necessary minerals, sugar, vitamins, and nitrogenous elements for the development of microorganisms (Mossel, Mengerink, & Scholts, 1962). The samples were streaked on MacConkey Agar with a sterilized wire loop and maintained in an incubator at 37 °C. Plates were examined after 24 hours for the development of desired bacterial growth.

3.4 Catalase Test

Catalase is an essential enzyme in all pathogens because it protects them from oxidative damage. Catalase test is used for differentiation of catalase positive from catalase negative species. By adding hydrogen peroxide in the inoculum of bacteria, the presence of catalase enzyme is demonstrated. Oxygen bubbles are produced when a single colony is introduced as catalase enzyme converts hydrogen peroxide into water with liberation of oxygen (Taylor & Achanzar, 1972). Escherichia coli catalyzes H₂O₂ and converts it into oxygen and water which results in hasty bubbling. The presence of bubbles, which is a sign of oxygen release, suggests that vigorous bubbling is a discriminating feature.

3.5 Triple Sugar Iron test (TSI)

TSI test is used to check the bacteria’s ability to ferment carbohydrates and production of H2S gas. It includes three sugars, as the name implies (1% lactose, 1 % sucrose, and 0.1% glucose) In this medium bacteria is differentiated on the basis of sugars fermentation and hydrogen sulfide gas production (Hajna, 1945). Formation of bubbles and pH indicator phenol red turning yellow from red, indicated the presence of Escherichia Coli due to formation of fermented products.

3.6 Culturing and stock preparation of uropathogenic Escherichia coli

3.6.1 Culturing in Tryptic Soy Broth (TSB)

Trypticase Soy Broth (TSB) is used for general purpose of culturing Escherichia coli in laboratories as it contains nutrients that are necessary for bacterial growth.

3.6.2 Stock formation

Isolates cultured in TSB were collected and stored in 30 % glycerol. The purpose was to keep the cultures stable and to keep the cells safe. Glycerol accomplishes this by infusing the bacterial cell and stabilizing the cell structures, thereby protecting them from freezing crystal damage and keeping them alive in a frozen environment. The stock cultures were kept at -80°C for as long as possible, but at -20°C, they can be kept for future active work. Cell pellets were used to collect the cultures, which were then washed with autoclaved. Comosition of 30% glycerol is as follows;

• 30% Glycerol  30 ml
• Tryptic Soy Broth(autoclaved) 70ml

3.7 Molecular confirmation of Escherichia coli

Isolates were confirmed as Escherichia coli after morphological and biochemical identification, using the Polymerase Chain Reaction (PCR) at the molecular level. First, genomic DNA (gDNA) was extracted from revived isolate cultures. Gel electrophoresis was used to perform qualitative analysis on extracted gDNA.

3.7.1 Extraction of genomic DNA

By utilizing standard method of phenol chloroform: isoamyl alcohol (24:1) the extraction of genomic DNA of all isolates was performed (Nouws et al., 2020). For genomic DNA purification, chloroform was combined with isoamyl alcohol in a specific ratio (chloroform: isoamyl alcohol = 24:1)

3.8.1 DNA quality analysis by Agarose Gel Electrophoresis:

For testing integrity of the isolated genomic DNA (gDNA), 1% agarose gel was used. First, genomic DNA was stained with a 0.25 % bromophenol blue mixture (Allen et al., 1984). The gDNA was then passed via an agarose polymerized network from negative to positive electrodes while being subjected to an electric field in TBE buffer solution. Gel documentation system was utilized to view the integrated band of gDNA. Essentially, DNA is passed through an agarose meshwork gel based on molecule size and charge.

3.9.1 Molecular identification

Molecular identification of Escherichia coli was performed through polymerase chain reaction (PCR) using gene specific primers, uidA gene (Ghose, Guo, Haque, & biophysics, 2009) was targeted that encodes for β-glucoronidase. This enzyme catalyzes the hydrolysis of a glucuronide moiety from a variety of substrates and it also catalyzes the conversion of α –D glucuronosid ۔ to alcohol and D- glucoronate (Tabasi et al., 2015). The amplified regions were observed in 1.5% agarose gel electrophoresis using the gel electrophoresis sections.

Table 1: Sequence of uidA gene

Gene	Sequence of Primer (5´–3´)	Size of Product
uidA	ATCACCGTGGTGACGCATGTCGC CACCACGATGCCATGTTCATCTGC	486bp

3.10 Molecular Confirmation of Penicillin Resistance Gene

In uropathogenic Escherichia coli, tem gene encodes a protein which binds with penicillin like compounds through low affinity. This gene was targeted to confirm the resistance in isolates by using its primer (Iqbal, Saeed, & Zafar, 2009). PCR was applied to confirm the isolates. Primer sequence of tem gene is in Table 2,

Gene	Primer Sequence (5´–3´)	Product Size
tem	GCACGAGTGGGTTACATCGA GGTCCTCCGATCGTTGTCAG	311bp

4. Results:

4.1Collection of Uropathogenic Isolates:

One hundred and ninteen uropathogenic isolates were isolated from urine samples obtained from patients of various ages, both male and female, from different clinics and hospitals of Faisalabad and 109 isolates were confirmed as uropathogenic Escherichia coli after biochemical and molecular confirmation.

4.2Percentage distribution of age groups among UTI patients:

The majority of females were between the ages of 13 and 30 years old, while the majority of men were between the ages of 45 and 60 years.

Table Percentage distribution of age groups among UTI patients;

Sr.no	Age groups	Male	Female
1	2-10	1%	5%
2	11-12	4%	10%
3	13-30	2%	18%
4	31-45	6%	10%
5	46-60	20%	24%

4.2.1 Gender wise perecntage of UTI patients

The UTIs percentage in females was  76 % and 33%  in males, indicating a significantly higher infection rate in females than in men.

Fig. Gender wise perecntage of UTI patients

4.3       Morphological Identification of Uropathogens

4.3.1 Determination of bacterial growth on MacConkey agar

One-hundred-nine (109) isolates had mucoid brilliant pink colonies with a pink halo, indicating the presence of E.coli.

Fig.1: bright pink colonies of E.coli on macConky agar

4.3.2 Determining the Oxidation Property by Catalase Test

Catalase test was performed for all isolates of UPEC which gave the positive results on C.L.E.D as well as on MacConkey agar media. When colonies from isolates were dipped in 3% H2O2, they produced abundant and fast bubbles, which showed that all isolates were catalase-positive.

Fig 2 UPEC production of bubbles in 3% hydrogen peroxide.

4.3.3. Iron Test with Triple Sugar (TSI)

The capacity of bacteria to ferment glucose, lactose, and sucrose, as well as emit hydrogen sulphide gas, is indicated by TSI. The three sugars were fermented by Gram-negative bacilli that generated H2 S gas. The test was designed to distinguish the Enterobacteriaceae family from other gram-negative rods. Yellow color with cracks confirmed bacteria was E.coli.

Figure 3 Acid butt/acid slant with gas, no H2S, A/A

4.4 PCR-based Molecular confirmation of E.coli

Gel electrophoresis was used to check the purity of genomic DNA. Before using PCR on the isolated uropathogenic Escherichia coli, the DNA integrity was confirmed on a 1% gel. Gel electrophoresis was used to examine the DNA extraction results as shown in figure below.

Fig.4  Bacterial DNA visualization on UV illuminator

4.4.1 Molecular confirmation of Escherichia coli strain with uidA gene

For molecular characterization the isolates were verified by PCR using oligonucleotide primer sets that anneal to the E. coli uidA gene. One hundred nine (109) isolates were positive for the uidA gene out of a total of one hundred and fifty (140) samples. The PCR reaction result was examined using gel electrophoresis, as illustrated in figure below.

Figure 5          Amplicon size (486bp) of uidA gene was determined

4.4.2 Molecular Confirmation of Ampicillin Resistance Gene

The use of oligonucleotide primer pairs against the ampicillin resistance gene (tem gene) of UPEC resulted in PCR amplification of the corresponding gene with 311bps for the tem gene in UPEC genome recovered from isolates that were resistant to ampicillin. The most prevalent genes implicated in ampicillin resistance (tem gene).

Figure 6 Results for Molecular Confirmation of ampicillin Resistance Gene (tem PCR Amplification with 250bps) in UPEC

5 Discussion and Conclusion:

Uropathogenic Escherichia coli (UPEC) are the most frequent cause of urinary tract infections all over the world. E.coli is a gram-negative rod-shaped bacterium and UPEC strains have plenty of structural ( pili, fimbriae, curli, flagella) and secreted (iron acquisition systems, toxins) virulence contributing factors to their ability to cause disease. Despite various host defense systems, UPEC can survive in the urinary tract and serve as a reservoir for recurring infections and severe complications. A recent study in Brazil describes these trends and shows that complex CA-UTIs, as well as UTIs caused by MDR/ESBL and biofilm-forming E. coli, are common among hospitalized patients. Diabetes, neurologic, and neoplastic disorders were thought to enhance the likelihood of having a UTI caused by MDR E. coli (de Souza Moura et al., 2020).

The purpose of this study was to determine the prevalence and molecular characterization of MDR and XDR uropathogenic Escherichia coli collected from various hospitals of Faisalabad, Pakistan’s largest industrial hub and the second largest city by population in Punjab. A total of 119 clinical samples were collected for the isolation of UPEC. Isolation and biochemical tests (including MacConkey agar, catalase test, and triple sugar iron test) were used to identify UPEC; following biochemical identification, these isolates were verified by PCR using a specific uidA gene, and 109 samples were uid positive out of 119 isolates. UPEC is regarded as a critical priority microorganism since it is associated with high levels of resistance and have become difficult to eliminate due to its persistence in the environment of healthcare facilities. Resistance in UPEC has developed significantly during last two decades, posing a serious challenge for antibiotics due to emergence of resistant variants.

According to our research prevalence of UPEC was found 77% (109 isolates) of the 119 culture positive urine samples which is consistent with the findings of other developing countries. According to a previous published report of a tertiary care hospital in Bangladesh, the prevalence of Escherichia coli was 61.6%, having resistance frequency 77.6% respectively. The prevalence of E.coli was 68% (Kothari & Sagar, 2008). According to the findings of this research, the UTIs percentage in females was (76 %) and (33 %) in males, indicating a significantly higher infection rate in females than in men in this research and this data is almost similar to other researches across the globe. According to earlier data, the percentages UTI caused by UPEC in females were (67%) and (33%) in males. Females are more likely to be infected than men, according to a research, with 53 (31.55% ) of patients being males and 115 (68.45 % ) of patients being females. The majority of infected females were aged 14 to 44, whereas the majority of infected males were aged 52 to 85. Our study investigation found that the majority of females were between the ages of 13 and 30 years old, while the majority of men were between the ages of 45 and 88 years and this data was almost similar to finding given in previous articles. Due to various pathophysiological risk factors, women have a higher percentage of UTIs than males. Pregnant women are especially susceptible to UTIs Antimicrobial resistance has risen significantly against some drugs. Previously, a wide spectrum of antibiotics had been efficiently used to treat UTIs, but there is now a low susceptibility rate that indicates significant drug resistance against many of these drugs.

Because this study gives up-to-date information on the most effective medicines for UTIs in the local community, antibiotic abuse will be avoided, resulting in a faster recovery rate and less waste of money and time. We conclude that MDR uropathogenic E.coli is a common cause of UTIs. The primary causes in undeveloped countries are doctors’ irresponsible use of antimicrobial medicines and easy accessibility without a prescription. At the molecular level, there is a resistance profile of uropathogenic E.coli invading the urinary system, and more information is necessary so that physicians can be more equipped to handle with these infections.

References:

1. Ahmed, S., Yadegari, H., Naz, A., Biswas, A., Budde, U., Saqlain, N., . . . Masood, S. J. H. (2019). Characterization of the mutation spectrum in a Pakistani cohort of type 3 von Willebrand disease. 25(6), 1035-1044.
2. de Souza Moura, W., de Souza, S. R., Campos, F. S., Cangussu, A. S. R., Santos, E. M. S., Andrade, B. S., . . . Products. (2020). Antibacterial activity of Siparuna guianensis essential oil mediated by impairment of membrane permeability and replication of pathogenic bacteria. 146, 112142.
3. Flores-Mireles, A. L., Walker, J. N., Caparon, M., & Hultgren, S. J. J. N. r. m. (2015). Urinary tract infections: epidemiology, mechanisms of infection and treatment options. 13(5), 269-284.
4. Ghose, R., Guo, T., Haque, N. J. A. o. b., & biophysics. (2009). Regulation of gene expression of hepatic drug metabolizing enzymes and transporters by the Toll-like receptor 2 ligand, lipoteichoic acid. 481(1), 123-130.
5. Guyer, D. M., Henderson, I. R., Nataro, J. P., & Mobley, H. L. J. M. m. (2000). Identification of sat, an autotransporter toxin produced by uropathogenic Escherichia coli. 38(1), 53-66.
6. Hajna, A. J. J. o. b. (1945). Triple-sugar iron agar medium for the identification of the intestinal group of bacteria. 49(5), 516-517.
7. Iqbal, M., Saeed, A., & Zafar, S. I. J. J. o. h. m. (2009). FTIR spectrophotometry, kinetics and adsorption isotherms modeling, ion exchange, and EDX analysis for understanding the mechanism of Cd2+ and Pb2+ removal by mango peel waste. 164(1), 161-171.
8. Jansen, A., & Kielstein, J. J. E. (2011). The new face of enterohaemorrhagic Escherichia coli infections. 16(25), 19898.
9. Kaper, J. B., Nataro, J. P., & Mobley, H. L. J. N. r. m. (2004). Pathogenic escherichia coli. 2(2), 123-140.
10. Kothari, A., & Sagar, V. J. T. J. o. I. i. D. C. (2008). Antibiotic resistance in pathogens causing community-acquired urinary tract infections in India: a multicenter study. 2(05), 354-358.
11. Minino, A. M., & Smith, B. L. (2001). Deaths: preliminary data for 2000.
12. Mossel, D., Mengerink, W., & Scholts, H. J. J. o. B. (1962). Use of a modified MacConkey agar medium for the selective growth and enumeration of Enterobacteriaceae. 84(2), 381-381.
13. Nouws, S., Bogaerts, B., Verhaegen, B., Denayer, S., Piérard, D., Marchal, K., . . . De Keersmaecker, S. C. J. S. r. (2020). Impact of DNA extraction on whole genome sequencing analysis for characterization and relatedness of Shiga toxin-producing Escherichia coli isolates. 10(1), 1-16.
14. Russo, F., Johnson, C. J., Johnson, C. J., McKenzie, D., Aiken, J. M., & Pedersen, J. A. J. J. o. G. V. (2009). Pathogenic prion protein is degraded by a manganese oxide mineral found in soils. 90(1), 275-280.
15. Tabasi, M., Karam, M. R. A., Habibi, M., Yekaninejad, M. S., Bouzari, S. J. O. p. h., & perspectives, r. (2015). Phenotypic assays to determine virulence factors of uropathogenic Escherichia coli (UPEC) isolates and their correlation with antibiotic resistance pattern. 6(4), 261-268.
16. Taylor, W. I., & Achanzar, D. J. A. m. (1972). Catalase test as an aid to the identification of Enterobacteriaceae. 24(1), 58-61.