Rutaba Rauf¹,Rukhama Rauf¹

1.Nishter Medical University,Multan,Pakistan

ABSTRACT

Escherichia coli infections caused by Diarrheagenic E. coli (DEC) and Uropathogenic E. coli (UPEC) are the leading cause of morbidity and mortality in the developing world responsible for seventy percent cases of Urinary Tract Infections (UTIs) and diarrhea. Another emerging but neglected problem is the infections caused by invasive non-typhoidal salmonellae (iNTS) which have particularly been highlighted in many countries during recent years. E. coli and salmonellae are the major enteropathogens and their cooccurrence can worsen the situation. There are limited studies regarding drug resistance profiling of these enteropathogens in Pakistan. This study was designed to investigate the antimicrobial resistance and molecular characterization of E. coli and iNTS strains isolated from the local population with their drug resistance profiling including their combined impact. After morphological and biochemical identification of E. coli and iNTS isolates, molecular characterization was done by PCR amplification by using gene specific primer uidA for E. coli and species-specific primers for Salmonellae. A complete antimicrobial resistance (100%) was observed in Penicillin and Erythromycin. Azithromycin (80%), Cefixime and Ceftriaxone (65%), Cefotaxime (65%), Nalidixic acid (53%), Kanamycin (46%), Piperacillin (84%), Aztreonam (34%), Trimethoprim (46%), Meropenem (17%), and Tobramycin (13%) resistance patterns were observed in E. coli. Susceptibility pattern of NTS showed 76% resistance to Mupirocin, Novobiocin (72%), Pipercillin (64%), Ciprofloxacin (60%), Kanamycin (44%), Amoxicilin (64%), Trimethoprim (24%), Nalidixic acid (48%), and Cefatixozime (60%). Among all these drugs Fosfomycin was found to be the most effective drug as it showed 100% efficacy. This study revealed that E. coli is more prevalent than iNTS but the prevalence of iNTS is also increasing day by day. This study will be helpful in exploring antibiotic resistance profiles of enteropathogens which will be effective in intervention and management of the consequent diseases. Effect of anti biotic resistance against typhoid were checked in Rattus norvegicus domestica rats  and histology was interpreted.

Keywords: UTIs, Drug Resistance, Disc diffusion test, iNTS, E. coli, DEC, Rattus norvegicus domestica rats

INTRODUCTION

 

Escherichia coli is a Gram-negative, rod-shaped bacterium from the family Enterobacteriaceae. It can grow both aerobically and anaerobically preferably at 37°C and can either be non-motile or motile with peritrichous flagella. E. coli is readily isolated from urine samples by plating on selective media. The change in pH due to lactose fermentation can be used to differentiate between lactose-fermenting and non-lactose-fermenting strains, as lactose-positive E. coli colonies will appear red or pink on media such as MacConkey agar .Most E. coli reside in intestinal tract of warm-blooded animals including humans. Some strains are harmless, and some are highly toxic. Pathogenic E. coli are characterized based on their virulence factors. E. coli cause wide range of infections that span from intestinal tract to urinary tract .E. coli can be grown easily, and its genome can be easily manipulated which makes it common workhorse and one of the best prokaryotic model organisms. Today, E. coli is used as a host cell in laboratories worldwide for foreign DNA sequences and their protein products.Along with UTIs, diarrhea is a serious public health issue that is a leading cause of morbidity and mortality among newborns and young children. Diarrheal infections are more common in low- and middle-income nations in Africa, Asia, and Latin America, with deadly consequences owing to poor living conditions which includes inadequate water supply, unhygienic conditions, sanitation, and lack of education are all contributing factors.E. coli strains that cause diarrhea are one of the most common etiological agents of diarrhea, with strains evolving by acquiring a specific set of features through horizontal gene transfer.Specific combinations were generated based on the set of virulence determinants obtained, determining the currently known E. coli pathotypes, which are collectively known as diarrheagenic E. coli (DEC). Enteropathogenic E. coli (EPEC), enterohemorrhagic (Shiga toxin-producing) E. coli (EHEC/STEC), enteroaggregative E. coli (EAEC), enterotoxigenic E. coli (ETEC), and enteroinvasive E. coli (ETEC) are the five DEC pathotypes that differ in their preferred host colonization sites, virulence mechanisms, and clinical symptoms and consequences.

Antibiotic-resistant pathogens that are resistant or impossible to treat are on the rise, posing a global health threat. Antibiotic resistance is encoded by several genes, many of which can be passed from one bacterium to the next. All present antibiotics have resistance mechanisms, and only a few new antibiotics are being developed. Antibiotic resistance can develop because of a decrease in drug intracellular concentration, target site change or protection, or direct antibiotic inactivation. The developing antibiotic resistance in E. coli is of great concern because it is major pathogen.Misuse of antibiotics may lead to resistance in microorganisms and make their treatment more difficult. E. coli is susceptible to different anti-microbial agents, but this microbe also has capability to show resistance. E. coli has developed resistance against different antibiotics like amoxicillin, spectinomycin or streptomycin, tetracycline and trimethoprim-sulfamethoxazole/Enrofloxacin.Diarrheal infection is the leading cause of death among children in developing countries accounting for approximately 20% of all childhood deaths. Shigella caused 63713 deaths among children younger than 5 years in 2016 and was frequently associated with diarrhea across all adult age groups increasing in elderly people with broad geographical distribution. Shigella was the second leading cause of diarrheal mortality in 2016 among all ages accounting for 212 438 deaths and about 13.2% of all diarrhea deaths. ETEC was the eighth leading cause of diarrhea mortality in 2016 among all age groups, accounting for 51,186 deaths and about 3.2% of diarrhea deaths. ETEC was responsible for about 4.2% of diarrhea deaths in children younger than 5 years.Another emerging but neglected problem is the infections caused by invasive non-typhoidal salmonellae (iNTS) which have particularly been highlighted in the low- and middle- income countries during recent years. Salmonellae are divided into two groups typhoidal serotypes and non-typhoidal serotypes. Salmonella is gram-negative and rod-shaped from the family of Enterobacteriaceae. In undeveloped countries there is high morbidity and mortality rate due to this bacterium.A common cause for bloodstream infections world-wide is Non-typhoid Salmonella (iNTS), with greater risks for HIV-infected individuals and children with malaria illness and malnutrition. It is the major cause of diarrhea worldwide, particularly in Africa. NTS gastroenteritis, unlike Salmonella Typhi and Salmonella Paratyphi, is commonly considered to be acquired by human beings in livestock reservoirs. Many ways, including animal foods, eggs, poultry, uncooked meat, infected products of animal waste, contact with animals or their surroundings, and contaminated waters, can lead to transmission of gastroenteritis causing NTS to humans. The genomic degradation of the African strains responsible for iNTS illness appears to be progressively adapted to an invasive lifestyle.The burden of Salmonella infections is enormous. Globally, NTS is responsible for an annual 93 million infections and 155000 deaths. Out of 93M illnesses, 80M are foodborne. Salmonella belongs to family Enterobacteriaceae and is medically important, causing pathogenesis in both animals and humans. Genus Salmonella contains two species, Salmonella enterica and Salmonella bongori. This bacterial lineage is ecologically diverse and contains several influential pathogens. The most prominent species of this genus is Salmonella enterica which is predominantly linked with gastroenteritis in humans and has more than 2500 serovars and is divided into six subspecies. These serovars are classified based on differences in structures of flagellar, lipopolysaccharides (LPS) and somatic antigens. The six subspecies of S. enterica are subspecies enterica, subsp. arizonae, subsp. houtenae, subsp. salamae, subsp. diarizonae and subsp. indica. Salmonella enterica subsp. enterica contains most of the pathogenic serovars including the ones responsible for enteric fever.

METHODOLGY

           Sample collection

             Sample collection from urine

Urine samples were collected in sterile vessels from various clinical laboratories in Saudi Arabia. The samples were collected for isolation of E. coli responsible for urinary tract infections (UTIs). Samples were streaked on nutrient agar plate and kept in incubator at 37^oC overnight. Sterile vessels were used for collection of samples which were transferred to Health Biotechnology Laboratory, Department of Bioinformatics and Biotechnology. Samples that were collected were further proceeded for analysis.

Sample collection from faeces

Stool samples were collected in sterile disposable containers covered with lid. The container in which the samples were collected were dry and clean Samples were streaked on nutrient agar plate and kept in incubator at 37^oC for 1 day. Collected samples obtained from various laboratories.

          Isolation and Biochemical identification of E. coli and Salmonellae

Growth on MacConkey Agar

The agar media was used for streaking of the collected samples for the isolation of E. coli and invasive non-typhoidal salmonella strains. After preparing the media, samples were streaked on MacConkey Agar by using cotton swabs and kept in an incubator at 37°C. After24 hours, plates were checked for the growth of desired microorganism. This medium differentiates the colonies of lactose fermenters bacteria and lactose non-fermenters bacteria which can be easily detected.

Catalase Test:

The catalase test was used to distinguish between catalase positive and catalase negative microbes. When inoculum was brought by loop into hydrogen peroxides then due to quick release of oxygen air bubbles produced.

H₂O₂                     2H₂O +O₂ + Bubbles

Fig: Picking of colonies with the help of sterile toothpick

Triple Sugar Iron Test

An inoculating needle was sterilized completely on the Bunsen until it was appeared as red hot. Allow time for the needle to cool down. When the needle was cold enough to handle, carefully selected an isolated colony from the MacConkey agar plate and inject it into the butt, followed by slant streaking.In case of E. coli, the slant appeared yellow due to the change in P^H indicator. In case of salmonellae , slant appeared red and black precipitates were produced due to the reduction of Sulphur. This medium was prepared in the form of slants to facilitate the growth of both aerobic and anerobic bacteria.

Fig: TSI test tubes kept at room temperature

Stock Formation

Long term storage of confirmed isolates requires the formation of stocks. The bacterial glycerol stocks were formed to store the desired DNA for longer period at -20^oC and at – 80^oC. 30% glycerol solution was used to preserve the bacteria. Glycerol stabilizes  frozen bacteria, protects cell membranes, and keeps the cells alive.

Culturing in Tryptic Soy Broth Medium

After biochemical confirmation of E. coli and salmonellae, selective colonies were picked from MacConkey agar plates which had been identified both by Triple Sugar Iron test and catalase test and inoculated in tryptic soy broth.

             DNA extraction

The genomic DNA of E. coli and Salmonella was extracted by using standard phenol chloroform extraction method.

Table : Preparation of TE Buffer (10mM Tris-Cl)

Reagents	Volume
Tris base	12.1g
Distilled water	100ml
0.5M EDTA	2.0ml

A sterilized reagent bottle was taken and 2ml of EDTA and 12.1g of tris base was dissolved in 70ml of distilled water.After this, pH was checked by pH meter and adjusted at 8.3 by NaOH.Distilled water was added up to 100ml and autoclaved at 121^o for 15 minutes and then stored at room temperature.

Preparation of 10 % Sodium Dodecyl Sulphate

800ml of distilled water was taken in a glass reagent bottle and 100g of SDS was dissolved in it.Then pH was adjusted to neutral by adding HCl. Distilled water was added to make the final volume of 1L.Solution was autoclaved at 121°C for 15 minutes and stored at room temperature.

Preparation of Sodium acetate (3M)

          40.81g sodium acetate is dissolved in 80ml of distilled water. Adjusted the pH of solution at 4.8 by adding glacial acetic acid.Volume of the solution was adjusted up to 100ml by adding distilled water.Autoclaved the solution and then stored at room temperature.

Preparation of Chloroform: Isoamyl alcohol (24:1)

     48ml of chloroform was taken in a falcon tube of 50ml.After this, 2ml of Isoamyl alcohol was added with the help of pipette.Solution was mixed with gentle inversion and stored at 4^oC to avoid evaporation

Fig: Three layers (upper aqueous layer, central and bottom layers contain proteins and cell debris) after centrifugation.

DNA quality analysis

The quality of genomic DNA of E. coli and Salmonella was checked after the extraction of isolates by gel electrophoresis.

Polymerase Chain reaction

Polymerase chain reaction was used for molecular confirmation of E. coli and Salmonellae

isolates.

Primer Reconstitution

The commercially available primers were in lyophilized form, and they were reconstituted by adding a calculated amount of 10 mM Tris buffer. Before using, gently combine the ingredients.The tubes containing lyophilized primers were centrifuged and reconstituted by computing nano moles of primers in 10mM Tris buffer.

Dilute Stock Primer

             Diluted the stock primer 10 times for making PCR master mix.Labeled carefully for both forward            and reverse primers and stored at -20°C.

           Molecular Characterization of Escherichia coli

Molecular characterization of E. coli was done by using uidA gene.

Table : Primer sequence of uidA gene

Gene	Primer Sequence (5´–3´)	Product Size
uidA	ATCACCGTGGTGACGCATGTCGC   CACCACGATGCCATGTTCATCTGC	486

              Molecular Characterization of Salmonellae

Molecular characterization of Salmonellae was determined by using the primer sequence of invA gene.

Table : Primer sequence of invA gene

Gene	Primer Sequence (5´–3´)	Product Size
invA	GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC

   Procedure for PCR reaction mixture Table :      List of PCR ingredients

Sr. No	PCR ingredients	Quantity per reaction
1	25mM MgCl2	1.5µL
2	10X Taq Buffer +KCL-Mgcl2	2.5µL
3	Taq polymerase	0.2µL
4	Forward primer	1µL
5	Reverse Primer	1µL
6	2mM DNTPs	1µL
7	10mM Tris buffer	14µL
8	Template (Genomic DNA)	5µL

Autoclaved PCR tubes and Eppendorf were used for polymerase chain reaction mixture.PCR master mix was prepared for uidA gene of E. coli detection by adding both forward and reverse primers, Taq buffer, Tris buffer, MgCl₂, dNTPs and Taq polymerase and mixed them by using vortex. The thermal conditions of uidA gene for PCR cycling were following:

Steps	Temperature	Duration
1	94oC	Initial denaturation for 5mins.
2	94oC	Denaturation for 30sec.
3	50oC	Annealing for 30sec.
4	72oC	Extension for 30sec.
Repeat the steps 2-4 for 30 times
5	72oC	Final extension for 7min.
6	4oC	Hold

• ·         Thermal conditions that were used for the invA gene are given below:

Steps	Temperature	Duration
1	94oC	Initial denaturation for 4mins.
2	94oC	Denaturation for 1min.
3	64oC	Annealing for 30sec.
4	72oC	Extension for 1min.
Repeat the steps 2-4 for 30 times.
5	72oC	Final extension for 30 sec.
6	4oC	Hold

• After the completion of PCR, PCR products were stored at 4°C and checked PCR products on 1.5% TBE agarose gel.

Gel Electrophoresis

Agarose gel electrophoresis was used to visualized and separate PCR product according to their size.

Table : Composition of 1% agarose gel

Reagent	Volume
Agarose	1.2 g
0.5X TBE Buffer	120.0 ml
Ethidium Bromide	2.00 µl

Antimicrobial Susceptibility Testing

This test was performed using disc diffusion method. All the PCR confirmed isolates were used to check their susceptibility/resistance against different drugs.

Mueller Hinton Agar

Mueller Hinton Agar medium was used to check the susceptibility of microbes against drugs by disk diffusion method.

Figure: Mueller Hinton Agar plate

Antibiotic susceptibility testing

Antibiotic susceptibility testing will be done on Muller-Hinton agar (MHA) plates against the pathogens using commercial antibiotic discs. In each case a bacterial lawn was made on Mueller Hinton Agar medium by using sterile cotton swab. Plates will be incubated at 37°C for 24 hours.Antibiotic susceptibility was determined by measuring the inhibition zones in millimeters using a Vernier caliper or a scale. This test was performed by using thirty-four different drugs against E. coli belonging to six different groups of antibiotics. Sixteen antibiotics belonging to eight classes were used against Salmonellae to check their antibiotic susceptibility. Resistance shown by the pathogens were interpreted according to criteria provided by Clinical and Laboratory Standards Institute recommendations.

Listed below in the table are the drugs that were used in Antibiotic Susceptibility testing.

Table : List of drugs used in Antibiotic Susceptibility testing against E. coli

Sr. No	Drugs Name	Quantity	Sr. No	Drugs Name	Quantity
1	Erythromycin (E-15)	20µg	18	Nitrofurantoin (F-300)	300µg
2	Penicillin G (P-10)	5 µg	19	Gentamycin (CN-30)	30 µg
3	Ceftriaxone (CRO-30)	30 µg	20	Chloramphenicol (C-10)	10 µg
4	Cefotaxime (CTX-30)	30 µg	21	Ampicillin/Sulbactam (SAM-20)	20 µg
5	Cefixime (CFM-5)	5 µg	22	Nalidixic acid (NA-30)	30 µg
6	Ceftazidime (CAZ-30)	30 µg	23	Novobiocin (NV-30)	30 µg
7	Amoxicillin (AML-10)	10 µg	24	Kanamycin (K-30)	30 µg
8	Tobramycin (TOB-10)	10 µg	25	Trimethoprim (W-5)	5 µg
9	Pipmedic acid (PIP-120)	120 µg	26	Ceftizoxime (ZOX-30)	30 µg
10	Meropenem (MEM-10)	10µg	27	Cloxacillin (OB-5)	5 µg
11	Sulbactam Cefoparazone (SCF-109)	109 µg	28	Amoxycillin (AML-10)	10 µg
12	Ciprofloxacin (CIP-10)	10 µg	29	Spectinomycin (SH-10)	10 µg
13	Fosfomycin (FOS-50)	50 µg	30	Mupirocin (MUP-200)	200 µg
14	Moxifloxacin (MXF-5)	5 µg	31	Ticarcillin (TIC-75)	75 µg
15	Ampicillin/Sulbactam (SAM- 105)	105 µg	32	Aztreonam (ATM-30)	5 µg
16	Piperacillin/Sulbactam (TZP- 110)	110 µg	33	Amoxicillin linolenic acid (AMC- 30)	30 µg

Table : List of 17 drugs used in Antibiotic Susceptibility testing against Salmonellae

Sr No.	Drugs name	Quantity	Sr No.	Drugs name	Quantity
1	Nalidixic acid (NA-30)	30 µg	10	Ticarcillin (TIC-75)	75 µg
2	Novobiocin (NV-30)	30 µg	11	Ciprofloxacin (CIP-10)	10 µg
3	Kanamycin (K-30)	30 µg	12	Fosfomycin (FOS-50)	50 µg
4	Trimethoprim (W-5)	5 µg	13	Erythromycin (E 30)	30µg
5	Ceftizoxime (ZOX-30)	30 µg	14	Penicillin G	10 units
6	Cloxacillin (OB-5)	5 µg	15	Gentamycin (CN-30)	10µg
7	Amoxycillin (AML-10)	10 µg	16	Piperacillin (PRL-100)	100µg
8	Spectinomycin (SH-10)	10 µg	17	Cefadroxil (CFR-30)	30µg
9	Mupirocin (MUP-200)	200 µg

 

          DISCUSSION

Collection of samples

A total of 120 isolates were obtained from urine and faeces samples collected from patients of various ages, both male and female. 10 isolates from the fecal samples were identified as both containing E. coli and salmonellae, which was further confirmed by biochemical assays.

Table : Gender-wise frequency of samples isolated from urine samples.

Sr. No	Age groups	Isolates    from    male patients	Isolates from female patients
1	1-12 years	1%	3%
2	13-30 years	4%	11%
3	31-45 years	6%	17%
4	46-60	10%	29%
5	60 years and above	5%	14%

Figure : Distribution frequency of E. coli isolates in different age groups

Table : Gender-Wise distribution of samples isolated from fecal samples.

Sr. No	Age groups	Isolates      from      male patients	Isolates      from     female patients
1	1-12 years	5%	6%
2	13-30 years	10%	24%
3	31-45 years	12%	10%
4	More than 45 years	13%	20%

Fig: Percentages of Salmonellae isolated from different age groups

Morphological Identification of isolates:

All collected samples were cultured on MacConkey agar plate because MacConkey agar plate is used for the isolation of Enterobacteriaceae. Out of 120 urine samples, 78 samples showed lactose fermenting pink colonies on MacConkey agar. Colonies were dry, pink, and non-mucoid, surrounded by a darker pink zone.

Fig: Growth of E. coli on MacConkey Agar plate

The morphological characteristics of these 50 isolates on MacConkey agar plates were noted.

Fig: Growth of Salmonellae on MacConkey Agar plate

Biochemical identification

After noting the colonial morphology, biochemical tests were performed for the confirmation of E. coli and salmonellae including Triple Sugar Iron test, Catalase test.

Triple Sugar Iron test

All E. coli isolates which gave positive results on MacConkey agar plate were further confirmed on Triple sugar Iron test.

Fig: E. coli ferment glucose, dextrose and sucrose and CO2 is produced.

Triple sugar iron test was also done for all Salmonella pathogens which were isolated from MacConkey agar plates. After 24hrs of incubation, isolates of salmonellae gave positive results having reddish slant and yellowish butt with blackening due to the formation ofH₂S gas.

Figure : Non typhoidal salmonellae exhibits thick blackening due to H₂S gas production.

Table : Interpretation of TSI tubes

Media	Slant/ Butt	Fermentation
Alkaline/Acid	Red slant/yellow butt	Dextrose fermentation
Acidic/Acidic	Yellow slant/yellow butt	Dextrose, Lactose fermentation
Alkaline/ Alkaline	Red slant/ Red butt	No fermentation
Black Color	Black media	H2 S
Gas production	Bubbles/ Cracks	CO2/ H2

Catalase Test

Catalase test was also performed on those isolates which gave positive results on MacConkey agar plate. All samples of E. coli and Salmonellae which were identified on MacConkey agar and Triple sugar iron slants were further confirmed by catalase test. All samples gave positive results to catalase test.

Fig: Production of Oxygen bubbles in 3% Hydrogen peroxide

Analysis of DNA quality on gel electrophoresis

Gel electrophoresis was used to assess the integrity of genomic DNA. On a 1% gel, the integrity of the DNA was confirmed before molecular confirmation of isolated pathogens by PCR.

Fig: Genomic DNA of bacterial isolates

Molecular Identification of E. coli by Polymerase Chain Reaction (PCR)

After biochemical identification, DNA was extracted by using phenol chloroform method. The quality of DNA was checked on 1% agarose gel.uidA gene which was used for molecular confirmation of E. coli isolates. Out of 120 samples, 50 samples gave positive results for uidA gene.

Fig: PCR based confirmation of E. coli (Amplicon size 485bp)

Molecular confirmation of Salmonellae was done by using the invA gene. After the amplification of invA gene, it was confirmed on 1.5% agarose gel. Gel electrophoresis results are given in figure.

Fig: Confirmation of Salmonellae by targeting invA gene.

Molecular confirmation of Salmonella enterica serovar Typhimurium by Polymerase Chain Reaction

Salmonella enterica serovar Typhimurium was confirmed by using the specie specific primers. Gel electrophoresis results are given below in figure.

Fig: Molecular confirmation of Salmonella typhimurium isolates

Molecular confirmation of Salmonella enterica serovar Enteritidis by Polymerase Chain Reaction

Molecular confirmation of S. Enteritidis was also confirmed by using the specie specific primers. Results are checked on gel electrophoresis.

Fig: PCR results of specie specific primers of Salmonella Enteritidis

Interpretation of Antibiotic Susceptibility testing of E. coli

Antibiotic Susceptibility testing were performed against the positive isolates of E. coli by using 34 different drugs. The zones of inhibition produced by different drugs were measured.

Fig: Antimicrobial drug resistance profiles of different E. coli isolates on Mueller Hinton Agar plates

           Antibiotic resistance of E. coli

The drug resistance profiles of E. coli isolates against thirty-two (32) antimicrobial drugs . Out of these 32 drugs, 100% of the isolates were resistant to Erythromycin, Penicillin, Ciprofloxacin, Cloxacillin, Amoxycillin, Spectinomycin and Ticarcillin. Fosfomycin, tobramycin, Moxifloxacin, Piperacillin/sulbactam, Ceftazidime, Amoxicillin, and Ceftriaxone were observed to be the most effective drugs. Remaining drugs gave variable patterns.

Table : Antibiotic resistance and susceptibility pattern of E. coli

Sr No.	Antimicrobial Drugs	% Intermediate	% Resistance	% Susceptible
1	Erythromycin (E-15)	0%	100%	0%
2	Penicillin G (P-10)	0%	100%	0%
3	Ceftriaxone (CRO-30)	3%	65%	31%
4	Cefotaxime (CTX)	3%	65%	31%
5	Ciprofloxacin (CIP-5)	38%	53%	7%
6	Ceftazidime (CAZ-30)	24%	17%	60%
7	Azithromycin (AZM-10)	11%	80%	0%
8	Tobramycin (TOB-10)	6%	13%	79%
9	Pipmedic acid (PIP-120)	0%	37%	63%
10	Meropenem (MEM-10)	34%	48%	17%
11	Mupirocin (MUP-200)	34%	76%	32%
12	Ciprofloxacin (CIP-10)	0%	50%	50%
13	Fosfomycin (FOS-50)	0%	0%	100%
14	Moxifloxacin (MXF-5)	0%	82%	17%
15	Piperacillin/Sulbactam (TZP-110)	0%	89%	10%
16	Cefixime (CFM-5)	0%	65%	34%
17	Aztreonam (ATM-30)	17%	34%	48%
18	Sulbactam Cefoparazone (SCF109)	12%	78%	9%
19	Nitrofurantoin (F-300)	13%	3%	82%
20	Gentamycin (CN-30)	9%	50%	40%
21	Chloramphenicol (C-10)	3%	50%	40 %
22	Ampicillin/Sulbactam (SAM-20)	3%	10%	86%
23	Nalidixic acid (NA-30)	0%	53%	46%
24	Novobiocin (NV-30)	0%	82%	18%
25	Kanamycin (K-30)	38%	46%	15%
26	Trimethoprim(W-5)	0%	46%	53%
27	Ceftizoxime (ZOX-30)	3%	69%	10%
28	Cloxacillin (OB-5)	0%	100%	0%
29	Amoxycillin (AML-10)	0%	100%	0%
30	Spectinomycin (SH-10)	0%	100%	0%
31	Ticarcillin (TIC-75)	0%	100%	0%
32	Piperacillin (PRL-100)	0%	84%	15%

Interpretation of Antibiotic Susceptibility testing of Non Typhoidal Salmonellae

Antibiotic susceptibility testing was performed by using disc diffusion method against 17 different drugs. Testing was performed against all NTS isolates and results were interpreted by following the criteria provided by Clinical and Laboratory Standards Institute (CLSI).

Fig: Antimicrobial drug resistance pattern of Salmonellae on Mueller Hinton Agar.

Antibiotic resistance and susceptibility pattern of Salmonellae

Susceptibility pattern showed by Salmonella isolates is shown in Table 4.5. In contrast to

E. coli Fosfomycin found to be most effective drug as 100%isolates were susceptible to this drug . On the other hand, 100% of the isolates were resistant to Ticarcillin, Cefadroxil, Cloxacillin, Spectinomycin followed by the 96% resistant showed by Penicillin and Erythromycin.

Table : Antibiotic resistance and susceptibility profiles of Salmonella isolates

Sr No	Antimicrobial Drugs	% Intermediate	% Resistance	% Susceptible
1	Ticarcillin (TIC-75)	0%	100%	0%
2	Penicillin G (P-10)	4%	96%	0%
3	Ciprofloxacin (CIP-5)	28%	60%	12%
4	Amoxicillin (AML-10)	16%	64%	20%
5	Cefadroxil (CFR-30)	0%	100%	0%
6	Fosfomycin (FOS-50)	0%	0%	100%
7	Gentamycin (CN-30)	24%	20%	56%
8	Nalidixic acid (NA-30)	4%	48%	48%
9	Novobiocin (NV-30)	0%	72%	28%
10	Kanamycin (K-30)	28%	44%	28%

11	Trimethoprim(W-5)	16%	24%	60%
12	Ceftizoxime (ZOX-30)	0%	60%	40%
13	Cloxacillin (OB-5)	0%	100%	0%
14	Spectinomycin (SH-10)	0%	100%	0%
15	Mupirocin (MUP-200)	0%	76%	24%
16	Piperacillin (PRL-100)	12%	64%	24%
17	Erythromycin (E-30)	4%	96%	0%

 

 

Interpretation on Rats and its Histology:

Animals

            Adult male rats were used for all the experiments. The study was approved by the Animal Research Ethics Committee.

Rat model

The in vivo study included a control group (no graft

contamination), a contaminated group that did not receive

any antibiotic prophylaxis and three contaminated groups

that received.Each group included 15 animals and, to verify the results, the experiments were performed in duplicate. In the statistical

analysis, the data were merged and referred to all 30

animals from each pair of groups. Rats were anaesthetised

with ether, the hair on the back was shaved and the skin was interpreted.

Emergence of anti-microbial resistance in vivo

Positive cultures of samples from explanted grafts were screened for the in vivo emergence of resistance to rifampin and daptomycin. The bacteria were incubated at 35
C in 10 ml of MH broth until turbid and the turbidity of

the cultures were adjusted to match an OD of 1.25 at

550 nm, corresponding to approximately 109 CFU ml 1.

Successively, aliquots (0.1 ml) were treated with seven

consecutive cycles of dilution 1/100 in fresh, drug-free MH

broth and overnight incubation at 37
 -tested for susceptibility to each antibiotic.

 

 

DISCUSSION

UTIs are most common infectious disease that cause severe infections in elders, but this infection is very common in children. Females get more infection than males due to anatomical reasons. The major cause of UTIs is lactose fermenting infectious pathogens such as E. coli . E. coli is a gram-negative bacterium, and it belongs to family Enterobacteriaceae. E. coli normally resides in intestinal tract of humans and other animals. Some strains of E. coli are infectious and some are harmless. The purpose of this study was to isolate E. coli from urine samples collected from different laboratories and hospitals in Saudi Arabia and then confirmation of these isolates by biochemical tests and on molecular level. Antimicrobial susceptibility of these isolates against 34 different antibiotic drugs was carried out that are commonly used for the treatment of infectious diseases.The urine samples for this study were collected from different laboratories of Saudi Arabia. Out of 120 samples that had been collected, 70 isolates showed growth on MacConkey Agar plates. Twenty-five positive samples were collected from males while ninety-five samples were of females belonging to different age groups. The major isolated pathogen was characterized as Escherichia coli and its prevalence was about 65% and remaining was unidentified. Prevalence of E. coli was 40% in a study conducted by(Ahmad et al., 2015). Another study was conducted in Pakistan in which prevalence of E. coli was 30% .Out of 731 urine samples,149 showed positive for E. coli in a study in Iran (Ranjbar et al., 2014). One similar research carried out in India showed 62.50% isolates positive for E. coli.The difference between prevalence of E. coli around the world is probably due to environment because this microbe has great tendency to modify itself according to environmental conditions. The indiscriminate and unprescribed use of antibiotics has led to the emergence of MDR strains of E. coli in our population at a rapid rate which is comparable to regional as well as global trends. If antibiotics are used without any prescription, then it may be harmful because bacteria have ability to evolve themselves against these drugs and acquire resistance against these drugs. The result is these drugs are considered ineffective against those microbes.

Different antibiotics are used against different micro-organisms means that these antibiotics are broad spectrum . Some microbes are naturally resistant against some drugs, and some develop resistance by changing cell permeability, by producing some enzymes that cause inactivation of drugs or due to some other evolutionary mechanisms.The most effective drugs that are being prescribed now belong to group quinolones which includes Norfloxacin, Ofloxacin, Ciprofloxacin and Levofloxacin which prevent nucleic acid from duplicating and unwinding by an enzyme topoisomerase. E. coli has developed resistance against most of these drugs. E. coli is developing resistance against different antibiotics rapidly and this matter is of great concern.Carried out a study to check susceptibility of E. coli by disk diffusion and minimal inhibitory concentration method. In this study, 164 samples of E. coli were collected from urine samples taken from patients infected with UTIs. The antimicrobial susceptibility was checked against Ofloxacin, Nalidixic acid, Ciprofloxacin, Norfloxacin The percentage of resistance against these drugs was 44.5%, 49.3%, 40.2% and 41.4% respectively. The susceptibility was checked by disk diffusion method. This study revealed that E. coli has developed significant resistance against different drugs.The susceptibility of E. coli isolates was checked during 2008-2013 in India. Samples were collected from both genders. The prevalence of E. coli was 67.1%. When antimicrobial susceptibility test was performed, Penicillin was least effective against E. coli, then aminoglycosides and in the last cephalosporin (third generation). The resistance pattern was same as in other parts of world .Antimicrobial resistance is increasing day by in urinary tract infections, and which has become foremost concern regarding treatment. Three thousand and four ninety-eight E. coli isolates were collected in 2014 in Canada and United State for SMART. Susceptibility was checked by following CLSI (Clinical and Laboratories Standards Institute) recommendations. Prevalence of E. coli that produces beta-lactamase increased in 2014 especially in patients that suffered from various infections. Beta lactamase producing E. coli rate was lower in Canada as compared to United States. In United States, susceptibility against fluoroquinolones and cephalosporin was low than Canada. The resistance appeared more in females than males.

The conducted study showed that 43.3% isolates out of all samples collected from a mixed population of patients were uropathogenic E. coli, while 15% were diarrheagenic E. coli and 33.3% contained salmonella (iNTS). The rest 8.3% contained a combination of E. coli and salmonella.The antimicrobial susceptibility was checked and showed that E. coli was 100% resistant to penicillin, erythromycin, ampicillin, ciprofloxacin, and ticarcillin. Azithromycin (80%), Cefixime and ceftriaxone (65%), cefotaxime (65%), Nalidixic acid (53%), Kanamycin (46%), Piperacillin (84%), Aztreonam (34%), Trimethoprim (46%), Meropenem (17%), and Tobramycin (13%). Fosfomycin found to be most effective drug as it showed 95% susceptibility among all drugs. Females showed more resistance than males. Comparison with other studies showed that the trend of antimicrobial resistance is high all over the world.The local as well as regional picture of the increasing trends in E. coli resistance seems quite alarming. Although a big effort is still required for getting comprehensive results, but few available data show the gravity of the present scenario. The resistance of antimicrobial susceptibility of E. coli isolates in Iran against Cefuroxime was (100%), Ampicillin (95.83%) and Nitrofurantoin (81.63%) .

In a study carried out in Islamabad in 2016 the antimicrobial susceptibility testing showed that E. coli isolates were highly resistant to Cephalothin (80%), Co-trimoxazole (82%), Gentamicin (29%) and Amikacin (4%) (Ali et al., 2016). The antimicrobial susceptibility was checked in Punjab in Pakistan in 2015 which showed that E. coli isolates are 100% resistant against Ampicillin, Amoxicillin and Azetreonam.This comparison showed that E. coli isolates are highly resistant against Ampicillin, Penicillin, Azetreonam, Erythromycin, Ticarcillin and Amoxicillin all over the world. Sulbactum, Amikacin and Fosfomycin can be used as initial treatment for E.coli infection as per prescription of medical practitionar.Salmonella serovars such as S. Typhimurium and S. Enteritidis have previously been found to be the most prevalent serovars all across the world, including Pakistan (Mares, 2017). Salmonella infections in poultry and humans have increased in several countries, and one of the study showed that S. Infantis as the predominant source of salmonellosis in poultry have also increased. S. Infantis was identified as one of the most prevalent Salmonella serovars isolated from poultry in this study, and this was found to be the first report on the prevalence of S. Infantis in Pakistani poultry. They have also improved molecular techniques for detecting S. Infantis and its resistance gene.

Another study is carried out in Republic of Srpska in which scientists found that the frequency of S. Infantis in poultry was 22.6% which is consistent with the previous studeies where it showed the 26.8% among 108 Salmonella isolates, followed by S. Enteritidis (55%) (Ushakova et al., 2019). However, this figure is lower than the 83.9% recorded in another Ecuadorian study, which was followed by S. Enteritidis (14.5%) and S. Corvallis (1.6%) (Vinueza-Burgos et al., 2016). Differences in reports could be due to a variety of factors i.e,. geographic location, sample selection criteria, research season, and farm sanitary settings.

A multi-national study was conducted in 2009 which showed considerable resistance in non-typhoidal Salmonella strains from Taiwan (48.1%), Thailand (46.2%), Korea (36.5%), Singapore (24.5%), Philippines (14.9%), Hong Kong (7.1%), and Sri Lanka(Lee et al., 2009). This study showed that they have a significant prevalence of reduced susceptibility to ciprofloxacin (8.0% ).The rise in third-generation cephalosporin resistance, most notably in SK, is concerning because it is the medication of choice in Thailand for community-acquired invasive bacterial illness. In Taiwan and Thailand, NTS isolates have showed high levels of resistance to third-generation cephalosporins and fluoroquinolones.

The susceptibility of Salmonella isolates were checked againts 17 different antibiotic drugs belonging to eight groups. It showed that salmonella isoltaes were 100% resistant to Cefadroxil, Ticarcillin, Cloxacillin, spectinomycin and 96% resistant to penicillin and erythromycin. It also showed 76% resistance to Mupirocin, Novobiocin (72%), Pipercillin (64%), Ciprofloxacin (60%), Kanamycin (44%), Amoxicilin (64%), Trimethoprim (24%), Nalidixic acid (48%), and Cefatixozime (60%). Among all these drugs Fosfomycin was found to be the most effective drug as it showed 100% susceptibility.The high levels of antimicrobial resistance is a great cause for concern, especially in patients with underlying conditions, because resistance can make patient management even more difficult. Ampicillin (68.2%), TMP/SMX (17.0%), ciprofloxacin (1.2%), and third-generation cephalosporins (12.2%) were all shown the susceptibillity patterns againts isolates of E. coli and salmonella. These figures are similar to those found among children in a tertiary-care setting in Bangkok, where the rates were 68.3%, 33.9%, 3%, and 17.4%, respectivel.

Cephalosporin is a third-generation drug which is used to treat infections caused by gram- negative bacteria. It has long been used as an empirical treatment for severe gastrointestinal infections. The fact that DEC (18.11%) and NTS (9.52%) are resistant to CTX is alarming and should not be overlooked. It is possible that this third-generation cephalosporin resistance strain produces Extended Spectrum β- Lactamases (ESBL), enzymes that develop resistance to cephalosporin antibiotics, oxyimino-β-lactam synthetic medicines, and other penicillin antibiotics. The enzyme ESBL can be suppressed by using clavulanic acid (Zhang et al., 2018). In the present study it can be clearly seen that DEC and NTS showed resitant to cephalosproin and also significantresistance to penicilin and erythromycin.The drug resistance profiles as presented in our research can be helpful for clinicians for prescribing appropriate antibiotics for patients suffering from UTIs and diarrhea. As this study provides updated data regarding the effective drugs against UTIs, DEC and iNTS in local population, misuse of antibiotics will be prevented ultimately ensuring a fast recovery rate and preventing wastage of time and resources. Different comparative correlatives and parameters established in this study provide basis for future research in multiple dimensions.

Conclusion

One hundred and twenty (120) urine and fecal samples were collected from suspected patients. Samples were collected from different clinical laboratories and hospitals of Saudi Arabia.Morphological identification by using MacConkey agar medium and biochemical identification by using catalase test and triple sugar iron test was done on collected isolates for the confirmation of UTIs causing E. coli., DEC and iNTS.After isolation, stocks of isolates were prepared in 30% glycerol solutionsThe isolated pathogens were grown in TSB and incubated at 37°C for DNA extraction. The standard procedure of chloroform: isoamyl alcohol was used to extract genomic DNA from isolates.Polymerase Chain Reaction was used to accomplish molecular identification by using gene specific and species-specific primers. Molecular characterization of E. coli was done by using uidA gene. For the molecular characterization of Salmonella invA gene and species-specific primers of S. typhimurium and S. enteritidis were used.

Antimicrobial susceptibility was done on Mueller Hinton Agar (MHA) plate. Drug resistance patterns were studied by using 34 different antimicrobial drugs against

Drug resistance patterns of E. coli was Azithromycin (80%), Cefixime and ceftriaxone (65%), cefotaxime (65%), Nalidixic acid (53%), Kanamycin (46%), Piperacillin (84%), Aztreonam (34%), Trimethoprim (46%), Meropenem (17%), and Tobramycin (13%).Susceptibility pattern of NTS showed 76% resistant to Mupirocin, Novobiocin (72%), Pipercillin (64%), Ciprofloxacin (60%), Kanamycin (44%), Amoxicilin (64%), Trimethoprim (24%), Nalidixic acid (48%), and Cefatixozime (60%).Among all these drugs Fosfomycin found to be the most effective drug as it showed 100% susceptibility.This study will eventually help in the determination of drug resistance profile that can be immensely useful for clinicians to prescribe the accurate drug to the patients suffering from infections i.e., UTIs and diarrhea.

REFERENCES

Adachi, J. A., Jiang, Z.-D., Mathewson, J. J., Verenkar, M. P., Thompson, S., Martinez- Sandoval, F., Steffen, R., Ericsson, C. D., & DuPont, H. L. (2001). Enteroaggregative Escherichia coli as a major etiologic agent in traveler’s diarrhea in 3 regions of the world. Clinical Infectious Diseases, 32(12), 1706–1709.

Afzal, M. (2017). Antibiotic Resistance Pattern of Escherichia coli and Klebsiella Species in Pakistan: A Brief Overview. J Microb Biochem Technol, 9, 277–279.

Aghazadeh, M., Sari, S., Nahaie, M., Hashemi, S. S. R., & Mehri, S. (2015). Prevalence and antibiotic susceptibility pattern of E. coli isolated from urinary tract infection in patients with renal failure disease and renal transplant recipients. Tropical Journal of Pharmaceutical Research, 14(4), 649–653.

Ahmad, W., Jamshed, F., & Ahmad, W. (2015). Freequncy of escherichia coli in patients with community acquired urinary tract infection and their resistance pattern against some commonly used anti bacterials. Journal of Ayub Medical College Abbottabad, 27(2), 333–337.

Ahmed, F., Batool, H., & Nadeem, S. G. (2016). Antimicrobial Susceptibility Pattern of Uropathogens. RADS Journal of Biological Research & Applied Sciences, 7(1), 18– 23.

Akova, M. (2016). Epidemiology of antimicrobial resistance in bloodstream infections.

Virulence, 7(3), 252–266.

Ali, I., Rafaque, Z., Ahmed, S., Malik, S., & Dasti, J. I. (2016). Prevalence of multi-drug resistant uropathogenic Escherichia coli in Potohar region of Pakistan. Asian Pacific Journal of Tropical Biomedicine, 6(1), 60–66.

Ao, T. T., Feasey, N. A., Gordon, M. A., Keddy, K. H., Angulo, F. J., & Crump, J. A. (2015). Global burden of invasive nontyphoidal Salmonella disease, 2010. Emerging Infectious Diseases, 21(6), 941.

Ashton, P. M., Nair, S., Peters, T. M., Bale, J. A., Powell, D. G., Painset, A., Tewolde, R., Schaefer, U., Jenkins, C., & Dallman, T. J. (2016). Identification of Salmonella for public health surveillance using whole genome sequencing. PeerJ, 4, e1752–e1752.

Balasubramanian, R., Im, J., Lee, J. S., Jeon, H. J., Mogeni, O. D., Kim, J. H., Rakotozandrindrainy, R., Baker, S., & Marks, F. (2019). The global burden and epidemiology of invasive non-typhoidal Salmonella infections. Human Vaccines and Immunotherapeutics, 15(6), 1421–1426.

Baziboroun, M., Bayani, M., Poormontaseri, Z., Shokri, M., & Biazar, T. (2018). Prevalence and antibiotic susceptibility pattern of extended spectrum beta lactamases producing Escherichia coli isolated from outpatients with Urinary Tract Infections in Babol, Northern of Iran. Current Issues in Pharmacy and Medical Sciences, 31(2), 61–64.

Beyene, G., & Tsegaye, W. (2011). Bacterial uropathogens in urinary tract infection and antibiotic susceptibility pattern in jimma university specialized hospital, southwest ethiopia. Ethiopian Journal of Health Sciences, 21(2), 141–146.

Boireau, C., Morignat, É., Cazeau, G., Jarrige, N., Jouy, É., Haenni, M., Madec, J., Leblond, A., & Gay, É. (2018). Antimicrobial resistance trends in Escherichia coli isolated from diseased food‐producing animals in France: A 14‐year period time‐ series study. Zoonoses and Public Health, 65(1), e86–e94.

Carden, S., Okoro, C., Dougan, G., & Monack, D. (2015). Non-typhoidal Salmonella Typhimurium ST313 isolates that cause bacteremia in humans stimulate less inflammasome activation than ST19 isolates associated with gastroenteritis. Pathogens and Disease, 73(4).

Chandran, S. P., Sarkar, S., Diwan, V., Pathak, A., Shah, H., Tamhankar, A. J., Macaden, R., & Stålsby-Lundborg, C. (2017). Detection of virulence genes in ESBL producing, quinolone resistant commensal Escherichia coli from rural Indian children. The Journal of Infection in Developing Countries, 11(05), 387–392.

Coburn, B., Grassl, G. A., & Finlay, B. B. (2007). Salmonella, the host and disease: A brief review. Immunology and Cell Biology, 85(2), 112–118.

Croxen, M. A., & Finlay, B. B. (2010). Molecular mechanisms  of Escherichia coli

              pathogenicity. Nature Reviews Microbiology, 8(1), 26–38.

Croxen, M. A., Law, R. J., Scholz, R., Keeney, K. M., Wlodarska, M., & Finlay, B. B. (2013). Recent advances in understanding enteric pathogenic Escherichia coli. Clinical Microbiology Reviews, 26(4), 822.

Crump, J. A., & Heyderman, R. S. (2015). A perspective on invasive Salmonella disease in Africa. Clinical Infectious Diseases, 61(suppl_4), S235–S240.

Crump, J. A., Sjölund-Karlsson, M., Gordon, M. A., & Parry, C. M. (2015). Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clinical Microbiology Reviews, 28(4), 901–937.

Dean, S. V, Imam, A. M., Lassi, Z. S., & Bhutta, Z. A. (2013). Systematic review of preconception risks and interventions. Pakistan: Division of Women and Child Health, Aga Khan University.

Dong, N., Li, Y., Zhao, J., Ma, H., Wang, J., Liang, B., Du, X., Wu, F., Xia, S., & Yang,

X. (2020). The phenotypic and molecular characteristics of antimicrobial resistance of Salmonella enterica subsp. enterica serovar Typhimurium in Henan Province, China. BMC Infectious Diseases, 20(1), 1–11.

El-Hadedy, D., & El-Nour, S. A. (2012). Identification of Staphylococcus aureus and Escherichia coli isolated from Egyptian food by conventional and molecular methods. Journal of Genetic Engineering and Biotechnology, 10(1), 129–135.

Escherich, T. (1988). The intestinal bacteria of the neonate and breast-fed infant. Clinical Infectious Diseases, 10(6), 1220–1225.

Feasey, N. A., Cain, A. K., Msefula, C. L., Pickard, D., Alaerts, M., Aslett, M., Everett, D. B., Allain, T. J., Dougan, G., & Gordon, M. A. (2014). Drug resistance in Salmonella enterica ser. Typhimurium bloodstream infection, Malawi. Emerging Infectious Diseases, 20(11), 1957.

Feasey, N. A., Dougan, G., Kingsley, R. A., Heyderman, R. S., & Gordon, M. A. (2012). Invasive non-typhoidal salmonella disease: an emerging and neglected tropical disease in Africa. The Lancet, 379(9835), 2489–2499.

Feasey, N. A., Everett, D., Faragher, E. B., Roca-Feltrer, A., Kang’ombe, A., Denis, B., Kerac, M., Molyneux, E., Molyneux, M., & Jahn, A. (2015). Modelling the contributions of malaria, HIV, malnutrition and rainfall to the decline in paediatric invasive non-typhoidal Salmonella disease in Malawi. PLoS Neglected Tropical Diseases, 9(7), e0003979.

Firoozeh, F., Saffari, M., Neamati, F., & Zibaei, M. (2014). Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelonephritis. International Journal of Infectious Diseases, 29, 219–222.

Frieri, M., Kumar, K., & Boutin, A. (2017). Antibiotic resistance. Journal of Infection and Public Health, 10(4), 369–378.

Gal-Mor, O., Boyle, E. C., & Grassl, G. A. (2014). Same species, different diseases: how and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Frontiers in Microbiology, 5, 391.

Gomes, T. A. T., Elias, W. P., Scaletsky, I. C. A., Guth, B. E. C., Rodrigues, J. F., Piazza,

R. M. F., Ferreira, L., & Martinez, M. B. (2016). Diarrheagenic escherichia coli. Brazilian Journal of Microbiology, 47, 3–30.

Gordon, M. A. (2011). Invasive Non-typhoidal Salmonella Disease–epidemiology, pathogenesis and diagnosis. Current Opinion in Infectious Diseases, 24(5), 484.

Grimont, P. A. D., & Weill, F.-X. (2007). Antigenic formulae of the Salmonella serovars.

WHO Collaborating Centre for Reference and Research on Salmonella, 9, 1–166.

Haselbeck, A. H., Panzner, U., Im, J., Baker, S., Meyer, C. G., & Marks, F. (2017). Current perspectives on invasive nontyphoidal Salmonella disease. Current Opinion in Infectious Diseases, 30(5), 498.

Hiyoshi, H., Tiffany, C. R., Bronner, D. N., & Bäumler, A. J. (2018). Typhoidal Salmonella serovars: ecological opportunity and the evolution of a new pathovar. FEMS Microbiology Reviews, 42(4), 527–541.

Hunt, J. M. (2010). Shiga toxin–producing Escherichia coli (STEC). Clinics in Laboratory Medicine, 30(1), 21–45.

Igwe, J. C., Onaolapo, J. A., Ehimidu, J. O., Bolaji, R. O., Tytler, A. B., Ojiego, B. O., Kachallah, M., Okafo, N. C., Musa, A., & Sidi, M. T. (2015). Antibiotic Susceptibility Profile of E. coli Serotype 0157: H7 in ABUTH, Zaria, Nigeria. International Journal of TROPICAL DISEASE & Health, 1–8.

Jamil, J., Haroon, M., Sultan, A., Khan, M. A., & Gul, N. (2018). Prevalence, antibiotic sensitivity and phenotypic screening of ESBL/MBL producer E. coli strains isolated from urine; District Swabi, KP. Pakistan. J Pak Med Assoc, 68(11), 1704–1707.

Kariuki, S., & Dougan, G. (2014). Antibacterial resistance in sub-Saharan Africa: an underestimated emergency. Annals of the New York Academy of Sciences, 1323(1), 43.

Kariuki, S., Gordon, M. A., Feasey, N., & Parry, C. M. (2015). Antimicrobial resistance and management of invasive Salmonella disease. Vaccine, 33, C21–C29.

Kariuki, S., Revathi, G., Kariuki, N., Kiiru, J., Mwituria, J., Muyodi, J., Githinji, J. W., Kagendo, D., Munyalo, A., & Hart, C. A. (2006). Invasive multidrug-resistant non- typhoidal Salmonella infections in Africa: zoonotic or anthroponotic transmission? Journal of Medical Microbiology, 55(5), 585–591.

Khalil, I. A., Troeger, C., Blacker, B. F., Rao, P. C., Brown, A., Atherly, D. E., Brewer, T. G., Engmann, C. M., Houpt, E. R., & Kang, G. (2018). Morbidity and mortality due to shigella and enterotoxigenic Escherichia coli diarrhoea: the Global Burden of Disease Study 1990–2016. The Lancet Infectious Diseases, 18(11), 1229–1240.

Khan, M. I., Ochiai, R. L., Von Seidlein, L., Dong, B., Bhattacharya, S. K., Agtini, M. D., Bhutta, Z. A., Do, G. C., Ali, M., Kim, D. R., Favorov, M., & Clemens, J. D. (2010). Non-typhoidal Salmonella rates in febrile children at sites in five Asian countries. Tropical Medicine and International Health, 15(8), 960–963. https://doi.org/10.1111/j.1365-3156.2010.02553.x

Kingsley, R. A., Msefula, C. L., Thomson, N. R., Kariuki, S., Holt, K. E., Gordon, M. A., Harris, D., Clarke, L., Whitehead, S., & Sangal, V. (2009). Epidemic multiple drug resistant Salmonella Typhimurium causing invasive disease in sub-Saharan Africa have a distinct genotype. Genome Research, 19(12), 2279–2287.

Knodler, L. A., & Elfenbein, J. R. (2019). Salmonella enterica. Trends in Microbiology, 27(11), 964–965.

Lupindu, A. M. (2017). Isolation and characterization of Escherichia coli from animals, humans, and environment. Escherichia Coli-Recent Advances on Physiology, Pathogenesis and Biotechnological Applications, Samie A (Ed.). London, United Kingdom: IntechOpen Limited, 187–206.

MacLennan, C. A., & Levine, M. M. (2013). Invasive nontyphoidal Salmonella disease in Africa: current status. Expert Review of Anti-Infective Therapy, 11(5), 443–446.

Madajczak, G., & Szych, J. (2010). Evaluation of PremiTest Salmonella kit for identification of not-typable by conventional methods Salmonella. Medycyna Doswiadczalna i Mikrobiologia, 62(1), 29–36.

Majowicz, S. E., Musto, J., Scallan, E., Angulo, F. J., Kirk, M., O’Brien, S. J., Jones, T. F., Fazil, A., Hoekstra, R. M., & Studies, I. C. on E. D. “Burden of I. (2010). The global burden of nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases, 50(6), 882–889.

Mao, B.-H., Chang, Y.-F., Scaria, J., Chang, C.-C., Chou, L.-W., Tien, N., Wu, J.-J., Tseng, C.-C., Wang, M.-C., & Chang, C.-C. (2012). Identification of Escherichia coli genes associated with urinary tract infections. Journal of Clinical Microbiology, 50(2), 449– 456.

Marchello, C. S., Fiorino, F., Pettini, E., & Crump, J. A. (2021). Incidence of non-typhoidal Salmonella invasive disease: A systematic review and meta-analysis. Journal of Infection, xxxx.

Mares, M. (2017). Current Topics in Salmonella and Salmonellosis. BoD–Books on Demand.

McDermott, P. F., Zhao, S., & Tate, H. (2018). Antimicrobial resistance in nontyphoidal Salmonella. Microbiology Spectrum, 6(4), 4–6.

Murray, C. J. L., Rosenfeld, L. C., Lim, S. S., Andrews, K. G., Foreman, K. J., Haring, D., Fullman, N., Naghavi, M., Lozano, R., & Lopez, A. D. (2012). Global malaria mortality between 1980 and 2010: a systematic analysis. The Lancet, 379(9814), 413–

431.

Nakhjavani, F. A., Mirsalehian, A., Hamidian, M., Kazemi, B., Mirafshar, M., & Jabalameli, F. (2007). Antimicrobial susceptibility testing for Escherichia coli strains to fluoroquinolones, in urinary tract infections. Iranian Journal of Public Health, 36(1), 89–92.

Nyachuba, D. G. (2010). Foodborne illness: is it on the rise? Nutrition Reviews, 68(5), 257– 269.

Punpanich, W., Rattanasataporn, R., & Treeratweeraphong, V. (2012). Drug resistant tuberculosis in urban Thai children: a 10 year review. International Journal of Infectious Diseases, 16, e291.

Rajan, S., & Prabavathy, J. V. (2012). Antibiotic Sensitivity and Phenotypic Detection Of ESBL producing E. Coli Strains Causing Urinary Tract Infection In a Community Hospital, Chennai, Tamil Nadu, India.